I nanodropped the VDS staff sample of the protein.
Figure 1: VDS staff sample of SAL CA after it was concentrated and glycerol was added.
I ran another control enzyme assay with the new protein sample. The Sal CA was not active so I could not continue with research ):
Figure 2: Enzmye control assay of Sal CA from VDS staff sample. The enzyme is not active as indicated by the little change in absorbance.
I cleaned out my box and completed the one hour clean up.
Week 13
I ran a control enzyme assay. However, the assay did not show significant differences at various enzyme concentrations. This means that the enzyme might not be active.
Figure 1: Enzyme Control Assay at various enzyme concentrations
Started using Dr. B's expressed protein. Concentrated it and added 20% glycerol. I ran out of time to nanodrop so I will do that next week.
Week 12
Only did virtual screening stuff this week for lab. Ran and completed CBkinUT library (4000) ligands after third try. Ran second run and got a best ranking list with 55 compounds. Ordered two compounds from it
Figure 1: Sal CA protein concentration after 20% glycerol was added in order to store in the freezer
I will run a control assay on Monday.
Week 11
I finished drying my page gel but could not take a photo of it because I could not find the USB cable. I will upload it sometime next week.
I concentrated my protein after FPLC
Figure 1: Nanodrop of concentrated protein after FPLC
I ran three virtual screens on CBkinUT library. The first two failed but everything was corrected an as of Friday 11-11-11 the first virtual screen seems to be running properly. I will run the second run on Monday.
Week 10
I ran protein characterization on Monday. Let it wash for a few days until Thursday. Took a preliminary photo before drying as seen below.
Figure 1: Preliminary gel before drying. Lane 8 shows a thick band indicating the protein is present here. The other bands in Lane 8 indicate that Elution #1 should be cleaned through concentration and FPLC to better isolate the protein.
Lane 1: Skip
Lane 2: Protein Ladder (Fermentas Page Ruler Prestained Protein Ladder)
Lane 3: Sample 0 (Cell Lysate Before Induction)
Lane 4: Sample 1 (Cell Lysate After Induction)
Lane 5: Sample 2 (Soluble Fraction)
Lane 6: Sample 3 (Flow Through)
Lane 7: Sample 4 (Wash)
Lane 8: Sample 5 (Elution #1)
Lane 9: Sample 6 (Elution #2)
Lane 10: Skip
I concentrated the protein in Elution #1 before FPLC.
Figure 2: Nanodrop of SAL CA after protein was concentrated before FPLC.
I ran FPLC as well on Thursday.
Week 9
Prepared SDS page gel to run next week. Gel leaked the first first time so I had to redo it. Began running virtual screening for ChemBridge library but the Best Ranking List file showed in the wrong folder so I had to run it again. Ran ChemBridge library first run again on Friday.
Nanodrop of Elution #1 and #2 from protein expression. - that's a good yield! - Dr. B
Figure 1A: Nanodrop of Elution #1 (Sample 5 of .6OD Expression)
Figure 1B: Nanodrop of Elution #2 (Sample 6 of .6OD Expression)
Week 8
Virtual screening refresher failed again. The job has been run too many times so the files all have new names and its rather confusing. I moved on to virtual screening of my protein but this time I will make sure my file names are in order and organized. I attempted to run the first virtual screen but I could not get gold to run on two different processors to search 400 compound in the library. I will try again with the new tips next week.
I finished day 4 of expression and saved the supernanant.
While prepping for protein purification i slipped and dropped my .3 OD expression samples in the sink and lost it! I had to dispose of that one as barely any remained in the tube to be used for protein purification. I can only use the .6 OD expression sample to continue with my research.
I ran protein purification but did not have time to nanodrop the elutions. The elutions are in the 4 degree fridge and I will nanodrop them next week as well as run protein characterization hopefully.
Week 7
I had to rerun the second job of virtual drug screening refresher because of a fatal error. I created a pymol image for the pymol contest and finished the research report. I was not able to get much lab work done this week because of tests and the research assignments. I will run protein purification.
Week 6
I ran midi prep on the two 80 ml samples of DH5alpha cells will pNIC and my accepting vector. The samples were combined in the midi prep. The nanodrop of the concentration is below. I did not have a chance to send these results to sequencing on Wednesday but I did on Friday so the results should come in sometime next week.
Figure 1: Concentration of pNIC-Bsa 4 and Sal CA plasmid after midi prep.
On Wednesday I made LB media and prepped for expression for Day 1 on wednesday. I grew transformation plates from the plasmid that went through midi prep. I transformed it into BL21 bacteria cells.
On Thursday I transferred two colonies to the shaker in 50 mL.
On Friday I ran the 8 to 10 hour long process of expression and will finish Day 4 of the protocol next week. I also sent in the plasmid after midi prep to DNA sequencing.
Krishna - good deal. I am interested to see how it turns out. -- Dr. B
Week 5
Successfully inserted Sal CA gene into pNIC-BSA 4!!!!!! ---- Krishna, yeah! Good job on getting it to work. - Dr. B
Figure 1: Nanodrop of DNA pNIC Bsa 4 and Sal CA after miniprep. This sample was sent off to sequencing.
DNA sequencing Forward Primer Results
>filtered DNA sequence consisting of 1213 bases.
NNNNNNNNNNNNNNTTTANANGAGANNTACATATGCACCATCATCATCATCATTCTTCTG
GTGTAGATCTGGGTACCGAGAACCTGTACTTCCAATCCATGAAAGACATCGACACCCTGA
TCTCTAACAACGCGCTCTGGTCTAAGATGCTGGTTGAAGAAGACCCGGGCTTCTTCGAGA
AACTGGCGCAGGCGCAGAAACCGCGTTTCCTGTGGATCGGTTGCTCTGACTCTCGTGTTC
CGGCGGAACGTCTGACTGGTCTGGAACCGGGTGAACTGTTCGTTCACCGTAATGTTGCGA
ACCTGGTTATCCACACCGACCTGAACTGCCTGTCTGTTGTTCAGTACGCAGTTGATGTTC
TGGAAGTTGAACACATCATCATCTGCGGTCACTCTGGTTGCGGTGGTATCAAAGCGGCGG
TTGAAAACCCGGAACTGGGCCTGATTAACAACTGGCTGCTGCACATCCGTGACATCTGGC
TGAAACACTCTTCTCTGCTGGGTAAAATGCCGGAAGAACAGCGTCTGGACGCGCTGTACG
AGCTGAACGTAATGGAGCAGGTTTACAACCTGGGCCACTCTACCATCATGCAGTCTGCGT
Figure 1B: Nucleotide Blast with Reverse Primer Bacterial DNA and Optimized Sal CA sequence. The gene was successfully inserted.
I ran miniprep on the transformation pellet and have stored the sample in the fridge. I grew up more bacteria in the shaker in two tubes of 80mL LB. I spun them down and stored the pellets in the freezer.
I ran virtual screening refresher last week but the second run did not work properly. I ran the second run again on Thursday 9/29/11 so I will complete the analysis portion on Monday.
Week 4
I ran PCR clean up on my 4 PCR^2 samples and combined them into one tube.
Figure 1: Nanodrop of PCR^2 samples after PCR clean up. The nanodrop is clean with little contamination and a fairly high concetration.
I ran annealing and transformation again on Thursday. Hopefully I will see results and send it off to sequencing this weekend or the beginning of next week.
Week 3
I ran the restriction enzyme digest for pNIC-Bsa4 and ran it on a gel along with my 4 PCR^2 tubes. The pNIC-Bsa4 did not cut properly as there is only one band and it matches that of the uncut pNIC-Bsa4 plasmid.
Figure 1A: The pcr^2 samples are shown in lanes 3 through 7 and illustrating that it worked with a high concentration. Uncut pNIC-Bsa4 is seen in lane 9 and is shown as one band. Lane 10 is supposed to show cut pNIC-Bsa4 but is also only seen as one band meaning that the plasmid was not cut.
Lane 1: Skip
Lane 2: 100 bp Ladder
Lane 3: Sample A PCR2
Lane 4: Sample B PCR2
Lane 5: Sample
Figure 1B: Lanes 3 and 4 show cut pNIC-Bsa4 as there are two disticnt bands. Lane 3 shows almost three bands but that is because the gel was not loaded properly and DNA was punctured in front of the well. As a result the DNA smeared as seen by the glowing white above the second band in lane 3.
C PCR2
Lane 6: Sample D PCR2
Lane 7: Skip
Lane 8: PNIC Bsa-4 uncut plasmid
Lane 9: PNIC Bsa-4 cut plasmid
Joey had made extra restriction enzyme digest of pNIC-Bsa4 and I ran a gel to confirm if his two samples had cut properly. The gels in fact did cut properly as there are two distinct bands in each lane.
Lane 1: Skip
Lane 2: 100 bp ladder
Lane 3: “My Box” pNIC-Bsa4 Accepting Vector
Lane 4: “My Personal” pNIC-Bsa4 Accepting Vector
I completed the pyMol refresher lab that involved studying four protein molecules (2H2Q, 3CL9, 1U72, and 3HBB). The file for pyMol refresher is attached below.
Ran annealing and transformation protocol into PNICBsa4 but there was no growth on the plates. It was said that the restriction enzyme digest did not work properly and the PNICBsa4 was not cut properly.
I ran PCR^2 after this to amplify my gene concentration. The two largest concentrations are show in the nano drop below
Figure 1A: Nanodrop of sample C from PCR^2. It seems that there is some contamination in the gene of interest which will have to be looked in to.
Figure 1B: Nanodrop of sample D from PCR^2. It seems that there is some contamination in the gene of interest which will have to be looked in to.
Week 1
Figure 1: Gel of 2 Secondary PCR Samples.
Lane 1: Skip
Lane 2: 100 bp Ladder
Lane 3: Sample A Secondary PCR (74.3 ng/ul)
Lane 4: Sample B Secondary PCR (134.2 ng/ul)
Sample B was used for the next step of research as it had the highest concentration.
SUMMER RESEARCH
Transformation Efficiency Lab (6/8/11)
Figure 1A: Bacteria plate grown with 1 ng of plasmid DNA in tube A. 88 total colonies were found on this plate.
Figure 1B: Bacteria plate grown with 5 ng of plasmid DNA in tube B. 51 total colonies were found on this plate.
Figure 1C: Bacteria plate grown with 25 ng of plasmid DNA in tube C. 28 total colonies were found on this plate.
RE Digest Lab (6/10/11)
=
Figure 1: Gel of restriction enzyme digest of pGBR22. Lane 9 has undiluted uncut plasmid. As a result, too much DNA was added to the well creating an explosion effect.
Lane 2: 1kb DNA Ladder
Lane 5: EcoR I
Lane7: Pvu II
Lane 8: EcoR I + Pvu II
Lane 9: Uncut Plasmid
PCR for pGBR22 (6/17/11)
Figure 1: Gel of 1st PCR of pGBR22. From the gel it seems that sample C (Lanes 5 and 10) shows the most amplification. This is because these samples contained the most DNA.
Ruoyi Pu
Lane 2: Ladder
Lane 3: A 0.3 ng
Lane 4: B 3 ng
Lane 5: C 30 ng
Lane 6: D 0 ng (Control)
Krishna Patel
Lane 7: Ladder
Lane 8: A 0.3 ng
Lane 9: B 3 ng
Lane 10: C 30 ng
Lane 11: D 0 ng (Control)
PCR for pGFP (6/20/11)
Figure 1A: 1st Gel of PCR for pGFP. Besides the DNA ladders (Lane 2 and 11), only sample A (Lane 3) containing 1.58 ng of DNA showed up on the gel. This means that the PCR did not work. A possible source of error was that the TAQ polymerase was added to the samples and set out too long before being properly loaded into the PCR machine.
Lane 2: 100 bp Ladder
Lane 11: 100 bp Ladder
Primers: VDS 1 and 2 Forward and Reverse
Lane 3: A 1.58 ng
Lane 4: B 0.158 ng
Lane 5: C 0.0158 ng
Lane 6: D 0 ng (Control)
Primers: M13 Forward and Reverse
Lane 7: E 1.58 ng
Lane 8: F 0.158 ng
Lane 9: G 0.0158 ng
Lane 10: H 0 ng (Control)
Figure 1B: The Gel ran properly this time with all the bands showing up. Sample A contained the most ng of DNA and showed the highest yield. The control in lane 10 contains DNA meaning either the stock or the sample was contaminated.
Lane 2: 100 bp Ladder
Primers: VDS 1 and 2 Forward and Reverse
Lane 3: A 1.58 ng
Lane 4: B 0.158 ng
Lane 5: C 0.0158 ng
Lane 6: D 0 ng (Control)
Primers: M13 Forward and Reverse
Lane 7: E 1.58 ng
Lane 8: F 0.158 ng
Lane 9: G 0.0158 ng
Lane 10: H 0 ng (Control)
PCR protocol for pLIC sequencing vectors of pNIC-Bsa4
Figure 1: The PCR worked for me as seen in lanes 7-11. Sample A showed the highest yield (Lane 8) as it contained the most DNA. Sample C either did not work or is too faint to be seen.
Ruoyi Pu
Lane 2: Ladder
Lane 3: A
Lane 4: B
Lane 5: C
Lane 6: D
Krishna Patel
Lane 7: Ladder
Lane 8: A 3.14 ng
Lane 9: B 0.314 ng
Lane 10: C 0.0314 ng
Lane 11: D 0 ng (Control)
PCR for pNIC-Bsa4 cloning (Zhang Protein)
Figure 1: The PCR for the Zhang protein did not work. A possible cause was that the Hot Start KOD polymerase was used instead of KOD polymerase.
Lane 2: Ladder
Lane 3: A 0 mM MgCl2
Lane 4: B 1.5 mM MgCl2
Lane 5: C 2 mM MgCl2
Lane 6: D 4 mM MgCl2
Lane 7: E 6 mM MgCl2
Lane 8: F Control
PCR_PrimerOverlap (Carbonic Anhydrase for Salmonella
Figure 1: The gel was a success meaning that the PCR worked and the Carbonic Anhydrase sequence for Salmonella was successful amplified. The band in secondary PCR shows the amplification.
Lane 2: Ladder
Lane 3: Primary PCR (Primer Mix)
Lane 4: Secondary PCR (DNA Strand for Forward and Reverse Primer)
Lane 5: Ladder
Figure 2: Gel of PCR2 protocol. This procedure amplified the DNA strand found in the secondary PCR. Sample B contained the strongest amplification. Sample C failed to amplify.
Lane 2: Ladder
Lane 3: Sample A
Lane 4: Sample B
Lane 5: Sample C
Lane 6: Sample D
Figure 3A: Nanodrop of sample B after PCR2 protocol. The sample itself contained 30 ul. This means the sample contained approximately 5070 ng of DNA.
Figure 3B: Nanodrop of sample B after PCR cleanup. The elution sample contained 50 ul. This means the sample now contains approximately 2560 ng of DNA. This is half the amount of DNA prior to the PCR cleanup protocol.
Fall 2011 RESEARCH
Week 14
I nanodropped the VDS staff sample of the protein.I ran another control enzyme assay with the new protein sample. The Sal CA was not active so I could not continue with research ):
I cleaned out my box and completed the one hour clean up.Week 13
I ran a control enzyme assay. However, the assay did not show significant differences at various enzyme concentrations. This means that the enzyme might not be active.Started using Dr. B's expressed protein. Concentrated it and added 20% glycerol. I ran out of time to nanodrop so I will do that next week.
Week 12
Only did virtual screening stuff this week for lab. Ran and completed CBkinUT library (4000) ligands after third try. Ran second run and got a best ranking list with 55 compounds. Ordered two compounds from itI will run a control assay on Monday.
Week 11
I finished drying my page gel but could not take a photo of it because I could not find the USB cable. I will upload it sometime next week.I concentrated my protein after FPLC
I ran three virtual screens on CBkinUT library. The first two failed but everything was corrected an as of Friday 11-11-11 the first virtual screen seems to be running properly. I will run the second run on Monday.
Week 10
I ran protein characterization on Monday. Let it wash for a few days until Thursday. Took a preliminary photo before drying as seen below.Lane 1: Skip
Lane 2: Protein Ladder (Fermentas Page Ruler Prestained Protein Ladder)
Lane 3: Sample 0 (Cell Lysate Before Induction)
Lane 4: Sample 1 (Cell Lysate After Induction)
Lane 5: Sample 2 (Soluble Fraction)
Lane 6: Sample 3 (Flow Through)
Lane 7: Sample 4 (Wash)
Lane 8: Sample 5 (Elution #1)
Lane 9: Sample 6 (Elution #2)
Lane 10: Skip
I concentrated the protein in Elution #1 before FPLC.
I ran FPLC as well on Thursday.
Week 9
Prepared SDS page gel to run next week. Gel leaked the first first time so I had to redo it. Began running virtual screening for ChemBridge library but the Best Ranking List file showed in the wrong folder so I had to run it again. Ran ChemBridge library first run again on Friday.Nanodrop of Elution #1 and #2 from protein expression. - that's a good yield! - Dr. B
Week 8
Virtual screening refresher failed again. The job has been run too many times so the files all have new names and its rather confusing. I moved on to virtual screening of my protein but this time I will make sure my file names are in order and organized. I attempted to run the first virtual screen but I could not get gold to run on two different processors to search 400 compound in the library. I will try again with the new tips next week.I finished day 4 of expression and saved the supernanant.
While prepping for protein purification i slipped and dropped my .3 OD expression samples in the sink and lost it! I had to dispose of that one as barely any remained in the tube to be used for protein purification. I can only use the .6 OD expression sample to continue with my research.
I ran protein purification but did not have time to nanodrop the elutions. The elutions are in the 4 degree fridge and I will nanodrop them next week as well as run protein characterization hopefully.
Week 7
I had to rerun the second job of virtual drug screening refresher because of a fatal error. I created a pymol image for the pymol contest and finished the research report. I was not able to get much lab work done this week because of tests and the research assignments. I will run protein purification.Week 6
I ran midi prep on the two 80 ml samples of DH5alpha cells will pNIC and my accepting vector. The samples were combined in the midi prep. The nanodrop of the concentration is below. I did not have a chance to send these results to sequencing on Wednesday but I did on Friday so the results should come in sometime next week.
On Wednesday I made LB media and prepped for expression for Day 1 on wednesday. I grew transformation plates from the plasmid that went through midi prep. I transformed it into BL21 bacteria cells.
On Thursday I transferred two colonies to the shaker in 50 mL.
On Friday I ran the 8 to 10 hour long process of expression and will finish Day 4 of the protocol next week. I also sent in the plasmid after midi prep to DNA sequencing.
Krishna - good deal. I am interested to see how it turns out. -- Dr. B
Week 5
Successfully inserted Sal CA gene into pNIC-BSA 4!!!!!! ---- Krishna, yeah! Good job on getting it to work. - Dr. BDNA sequencing Forward Primer Results
>filtered DNA sequence consisting of 1213 bases.
NNNNNNNNNNNNNNTTTANANGAGANNTACATATGCACCATCATCATCATCATTCTTCTG
GTGTAGATCTGGGTACCGAGAACCTGTACTTCCAATCCATGAAAGACATCGACACCCTGA
TCTCTAACAACGCGCTCTGGTCTAAGATGCTGGTTGAAGAAGACCCGGGCTTCTTCGAGA
AACTGGCGCAGGCGCAGAAACCGCGTTTCCTGTGGATCGGTTGCTCTGACTCTCGTGTTC
CGGCGGAACGTCTGACTGGTCTGGAACCGGGTGAACTGTTCGTTCACCGTAATGTTGCGA
ACCTGGTTATCCACACCGACCTGAACTGCCTGTCTGTTGTTCAGTACGCAGTTGATGTTC
TGGAAGTTGAACACATCATCATCTGCGGTCACTCTGGTTGCGGTGGTATCAAAGCGGCGG
TTGAAAACCCGGAACTGGGCCTGATTAACAACTGGCTGCTGCACATCCGTGACATCTGGC
TGAAACACTCTTCTCTGCTGGGTAAAATGCCGGAAGAACAGCGTCTGGACGCGCTGTACG
AGCTGAACGTAATGGAGCAGGTTTACAACCTGGGCCACTCTACCATCATGCAGTCTGCGT
TGCGTGACCTGGACGTTACTGCGACCAATCGTGAAACCCTGGAAAACGGTTACCACAAAG
GTATCTCTGCGCTGTCTCTGAAATACATCCCGCACCAGTAACAGTAAAGGTGGATACGGA
TCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCA
CTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGA
NCAATAACTAGCATAACCCCNTGGGGCCTCTNAACGGGTCTTGAGGGGTTTTTTGCTGAA
AGGAGGAACTATATCCGGANTGNNGAATGGGNNNNGCCCTGTAGCGGCGCATTAAGCGCG
GCGGNNGNNGNGGNNACNCNCAGCNNGACCNCNNCACTTGCCAGCGCCNNNNCNNCCNNC
TCTTTNNCTTNNNTNNNNNNTTNNNCGNCNNNNNNCGNNTTNCCNNNANNNNNNAANTCG
GGGGNNNNNTNNNNCNANTNNNNGNTTNNNNNNNNNNNCNAANNNNGNNNNGNNNNNNNN
NNNNNGGGNNNNN
DNA sequencing Reverse Primer Results
>filtered DNA sequence consisting of 1729 bases.
ATGAAAGACATCGACACCCTGATCTCTAACAACGCGCTCTGGTCTAAGATGCTGGTTGAA
GAAGACCCGGGCTTCTTCGAGAAACTGGCGCAGGCGCAGAAACCGCGTTTCCTGTGGATC
GGTTGCTCTGACTCTCGTGTTCCGGCGGAACGTCTGACTGGTCTGGAACCGGGTGAACTG
TTCGTTCACCGTAATGTTGCGAACCTGGTTATCCACACCGACCTGAACTGCCTGTCTGTT
GTTCAGTACGCAGTTGATGTTCTGGAAGTTGAACACATCATCATCTGCGGTCACTCTGGT
TGCGGTGGTATCAAAGCGGCGGTTGAAAACCCGGAACTGGGCCTGATTAACAACTGGCTG
CTGCACATCCGTGACATCTGGCTGAAACACTCTTCTCTGCTGGGTAAAATGCCGGAAGAA
CAGCGTCTGGACGCGCTGTACGAGCTGAACGTAATGGAGCAGGTTTACAACCTGGGCCAC
NNNNNNNNNNNNNNNNNNNNGGTGGTGGTGGTGGTGCTCGAGTGCGGCCGCAAGCTTGTC
GACGGAGCTCGAATTCGGATCCGTATCCACCTTTACTGTTACTGGTGCGGGATGTATTTC
AGAGACAGCGCAGAGATACCTTTGTGGTAACCGTTTTCCAGGGTTTCACGATTGGTCGCA
GTAACGTCCAGGTCACGCAGCAGACCGTCGTTGATAGAGTACGCCCAACCGTGGATGGTA
ACGTTCTGACCACGTTTCCACGCAGACTGCATGATGGTAGAGTGGCCCAGGTTGTAAACC
TGCTCCATTACGTTCAGCTCGTACAGCGCGTCCAGACGCTGTTCTTCCGGCATTTTACCC
AGCAGAGAAGAGTGTTTCAGCCAGATGTCACGGATGTGCAGCAGCCAGTTGTTAATCAGG
CCCAGTTCCGGGTTTTCAACCGCCGCTTTGATACCACCGCAACCAGAGTGACCGCAGATG
ATGATGTGTTCAACTTCCAGAACATCAACTGCGTACTGAACAACAGACAGGCAGTTCAGG
TCGGTGTGGATAACCAGGTTCGCAACATTACGGTGAACGAACAGTTCACCCGGTTCCAGA
CCAGTCAGACGTTCCGCCGGAACACGAGAGTCAGAGCAACCGATCCACAGGAAACGCGGT
TTCTGCGCCTGCGCCAGTTTCTCGAAGAAGCCCGGGTCTTCTTCAACCAGCATCTTAGAC
CAGAGCGCGTTGTTAGAGATCAGGGTGTCGATGTCTTTCATGGATTGGAAGTACAGGTTC
TCGGTACCCAGATCTACACCAGAAGAATGATGATGATGATGGTGCATATGTATATCTCCT
TCTTAAAGTTAAACAAAATTATTTCTAGAGGGGAATTGNTATCCGCTCNCAATNNCCCTA
TAGTGAGTCGTANTNATTTCGCGGNATCGAGATCTCGATCCNCTACNNCGGACGCATCGT
GGCCGGGCNTCACCGGCGCCACAGGTGNNNNTTGCTGGCGNNTNNANNGNCGACNTCANC
GANNGGGGNAGATCGGGCNTCGCNNCTTNCNGGNNNATGANNNCTNGNTTNNNCNNNGGN
NATNGNNGNNNNGNCCNNNNCNNNNNNNNNNNNNNNNNNNNATNTCNNNNNNNNNNNCTN
TNCNNNNNNNNNNNNGGNNNNTNANNGGNCNNNNNCNNNNNNNNNNGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNN
I ran miniprep on the transformation pellet and have stored the sample in the fridge. I grew up more bacteria in the shaker in two tubes of 80mL LB. I spun them down and stored the pellets in the freezer.
I ran virtual screening refresher last week but the second run did not work properly. I ran the second run again on Thursday 9/29/11 so I will complete the analysis portion on Monday.
Week 4
I ran PCR clean up on my 4 PCR^2 samples and combined them into one tube.I ran annealing and transformation again on Thursday. Hopefully I will see results and send it off to sequencing this weekend or the beginning of next week.
Week 3
I ran the restriction enzyme digest for pNIC-Bsa4 and ran it on a gel along with my 4 PCR^2 tubes. The pNIC-Bsa4 did not cut properly as there is only one band and it matches that of the uncut pNIC-Bsa4 plasmid.Lane 2: 100 bp Ladder
Lane 3: Sample A PCR2
Lane 4: Sample B PCR2
Lane 5: Sample
Lane 6: Sample D PCR2
Lane 7: Skip
Lane 8: PNIC Bsa-4 uncut plasmid
Lane 9: PNIC Bsa-4 cut plasmid
Joey had made extra restriction enzyme digest of pNIC-Bsa4 and I ran a gel to confirm if his two samples had cut properly. The gels in fact did cut properly as there are two distinct bands in each lane.
Lane 1: Skip
Lane 2: 100 bp ladder
Lane 3: “My Box” pNIC-Bsa4 Accepting Vector
Lane 4: “My Personal” pNIC-Bsa4 Accepting Vector
I completed the pyMol refresher lab that involved studying four protein molecules (2H2Q, 3CL9, 1U72, and 3HBB). The file for pyMol refresher is attached below.
Week 2
Ran annealing and transformation protocol into PNICBsa4 but there was no growth on the plates. It was said that the restriction enzyme digest did not work properly and the PNICBsa4 was not cut properly.I ran PCR^2 after this to amplify my gene concentration. The two largest concentrations are show in the nano drop below
Week 1
Lane 1: Skip
Lane 2: 100 bp Ladder
Lane 3: Sample A Secondary PCR (74.3 ng/ul)
Lane 4: Sample B Secondary PCR (134.2 ng/ul)
Sample B was used for the next step of research as it had the highest concentration.
SUMMER RESEARCH
Transformation Efficiency Lab (6/8/11)RE Digest Lab (6/10/11)
=
Lane 2: 1kb DNA Ladder
Lane 5: EcoR I
Lane7: Pvu II
Lane 8: EcoR I + Pvu II
Lane 9: Uncut Plasmid
PCR for pGBR22 (6/17/11)
Ruoyi Pu
Lane 2: Ladder
Lane 3: A 0.3 ng
Lane 4: B 3 ng
Lane 5: C 30 ng
Lane 6: D 0 ng (Control)
Krishna Patel
Lane 7: Ladder
Lane 8: A 0.3 ng
Lane 9: B 3 ng
Lane 10: C 30 ng
Lane 11: D 0 ng (Control)
PCR for pGFP (6/20/11)
Lane 2: 100 bp Ladder
Lane 11: 100 bp Ladder
Primers: VDS 1 and 2 Forward and Reverse
Lane 3: A 1.58 ng
Lane 4: B 0.158 ng
Lane 5: C 0.0158 ng
Lane 6: D 0 ng (Control)
Primers: M13 Forward and Reverse
Lane 7: E 1.58 ng
Lane 8: F 0.158 ng
Lane 9: G 0.0158 ng
Lane 10: H 0 ng (Control)
Lane 2: 100 bp Ladder
Primers: VDS 1 and 2 Forward and Reverse
Lane 3: A 1.58 ng
Lane 4: B 0.158 ng
Lane 5: C 0.0158 ng
Lane 6: D 0 ng (Control)
Primers: M13 Forward and Reverse
Lane 7: E 1.58 ng
Lane 8: F 0.158 ng
Lane 9: G 0.0158 ng
Lane 10: H 0 ng (Control)
PCR protocol for pLIC sequencing vectors of pNIC-Bsa4
Ruoyi Pu
Lane 2: Ladder
Lane 3: A
Lane 4: B
Lane 5: C
Lane 6: D
Krishna Patel
Lane 7: Ladder
Lane 8: A 3.14 ng
Lane 9: B 0.314 ng
Lane 10: C 0.0314 ng
Lane 11: D 0 ng (Control)
PCR for pNIC-Bsa4 cloning (Zhang Protein)
Lane 2: Ladder
Lane 3: A 0 mM MgCl2
Lane 4: B 1.5 mM MgCl2
Lane 5: C 2 mM MgCl2
Lane 6: D 4 mM MgCl2
Lane 7: E 6 mM MgCl2
Lane 8: F Control
PCR_PrimerOverlap (Carbonic Anhydrase for Salmonella
Lane 2: Ladder
Lane 3: Primary PCR (Primer Mix)
Lane 4: Secondary PCR (DNA Strand for Forward and Reverse Primer)
Lane 5: Ladder
Lane 2: Ladder
Lane 3: Sample A
Lane 4: Sample B
Lane 5: Sample C
Lane 6: Sample D